Topic 2: Experience with detecting and identifying newly developed LMOs, unauthorized LMOs and stacked events
Mr. David Dobnik,
Slovenia#12825
Slovenia#12825
hace 10 meseshace 10 meses
Dear Colleagues,
Welcome to the online discussions of the Network of Laboratories for the Detection and Identification of Living Modified Organisms.
My name is David Dobnik and I am Assistant Professor and Research Councillor at the National Institute of Biology (NIB), Slovenia, with nearly two decades of hands‑on experience in developing, validating and transferring nucleic‑acid–based methods for the detection and identification of genetically modified organisms (GMOs/LMOs) across food, feed, seed and environmental matrices. I lead the GMO working unit and the GMO detection laboratory within NIB’s Department of Biotechnology and Systems Biology, which serves as National Reference Laboratory for GMO detection. I oversee end‑to‑end assay development, validation and implementation for qPCR and digital PCR (dPCR) workflows.
My professional focus is on scientifically robust, accreditation‑ready testing aligned with European regulatory requirements, directly paralleling the Cartagena Protocol’s emphasis on biosafety, traceability and inter‑laboratory comparability. I routinely translate advances in molecular analytics into standard operating procedures, reference‑material strategies and staff training - ensuring that new techniques are integrated without compromising quality systems.
Under this second topic, I would like to invite you to discuss your experience in detecting and identifying newly developed LMOs, unauthorized LMOs, and stacked events. In the 2023 discussions of this Network, participants noted that many laboratories had limited experience with the detection of newly developed or unauthorized LMOs. Some participants reported using expanded screening strategies, event-specific methods, and next-generation sequencing to improve detection, particularly when sequence information was incomplete or unavailable. Challenges remained, however, in detecting organisms produced through new genomic techniques, for which current methods were not fully adequate and sequencing-based approaches remained costly.
Considering these issues, it would be valuable to understand the progress made since 2023. In this regard, please keep in mind the following:
a) Could you describe your experience with the detection and identification of newly developed LMOs?
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
d) What challenges do you foresee in the near future for these types of LMOs?
I look forward to your insights.
David Dobnik
Welcome to the online discussions of the Network of Laboratories for the Detection and Identification of Living Modified Organisms.
My name is David Dobnik and I am Assistant Professor and Research Councillor at the National Institute of Biology (NIB), Slovenia, with nearly two decades of hands‑on experience in developing, validating and transferring nucleic‑acid–based methods for the detection and identification of genetically modified organisms (GMOs/LMOs) across food, feed, seed and environmental matrices. I lead the GMO working unit and the GMO detection laboratory within NIB’s Department of Biotechnology and Systems Biology, which serves as National Reference Laboratory for GMO detection. I oversee end‑to‑end assay development, validation and implementation for qPCR and digital PCR (dPCR) workflows.
My professional focus is on scientifically robust, accreditation‑ready testing aligned with European regulatory requirements, directly paralleling the Cartagena Protocol’s emphasis on biosafety, traceability and inter‑laboratory comparability. I routinely translate advances in molecular analytics into standard operating procedures, reference‑material strategies and staff training - ensuring that new techniques are integrated without compromising quality systems.
Under this second topic, I would like to invite you to discuss your experience in detecting and identifying newly developed LMOs, unauthorized LMOs, and stacked events. In the 2023 discussions of this Network, participants noted that many laboratories had limited experience with the detection of newly developed or unauthorized LMOs. Some participants reported using expanded screening strategies, event-specific methods, and next-generation sequencing to improve detection, particularly when sequence information was incomplete or unavailable. Challenges remained, however, in detecting organisms produced through new genomic techniques, for which current methods were not fully adequate and sequencing-based approaches remained costly.
Considering these issues, it would be valuable to understand the progress made since 2023. In this regard, please keep in mind the following:
a) Could you describe your experience with the detection and identification of newly developed LMOs?
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
d) What challenges do you foresee in the near future for these types of LMOs?
I look forward to your insights.
David Dobnik
Dear Mr. David,
Thank you again for this opportunity.
a) Our laboratory focuses on detecting suspected GMO maize and soybean. We use primers designed for specific target genomic regions, including promoters, terminators, and functional genes (the Cry gene for maize and the EPSPS gene for soybean). For internal controls, we use the lectin gene for soybean and the invertase gene for maize.
b) To date, we have not detected any unauthorized GMOs. This is likely because most crops in Ethiopia are organically cultivated. We will continue to monitor the GMO status of many types of crops.
c) To address some of the technical challenges and a lack of certain equipment, we are collaborating with local universities and research institutions.
d) A significant ongoing challenge is sourcing positive GMO control samples for our analyses, which are used as a reference. Currently, the only positive controls we have are for Maize Mon810 and Bt-cotton.
Thank you again for this opportunity.
a) Our laboratory focuses on detecting suspected GMO maize and soybean. We use primers designed for specific target genomic regions, including promoters, terminators, and functional genes (the Cry gene for maize and the EPSPS gene for soybean). For internal controls, we use the lectin gene for soybean and the invertase gene for maize.
b) To date, we have not detected any unauthorized GMOs. This is likely because most crops in Ethiopia are organically cultivated. We will continue to monitor the GMO status of many types of crops.
c) To address some of the technical challenges and a lack of certain equipment, we are collaborating with local universities and research institutions.
d) A significant ongoing challenge is sourcing positive GMO control samples for our analyses, which are used as a reference. Currently, the only positive controls we have are for Maize Mon810 and Bt-cotton.
Thank you for the opportunity to make a contribution to this discussion.
We have experienced a challenge to get information on detection methods for GM events that have not been approved in the European Union. The EU make methods available in the public domain for approved GM events. However, most other regulatory authorities do not follow a similar approach. For example, there does not appear to be any detection method available for HB4 soybean, HB4 wheat and DP-56113-9 maize (to name a few) in the public domain as it has not been approved in the EU. While a developer may be required to submit a method in the application for approval of a GM event to the regulatory authority, this method is considered confidential business information and is not made available in the public domain.
We have experienced a challenge to get information on detection methods for GM events that have not been approved in the European Union. The EU make methods available in the public domain for approved GM events. However, most other regulatory authorities do not follow a similar approach. For example, there does not appear to be any detection method available for HB4 soybean, HB4 wheat and DP-56113-9 maize (to name a few) in the public domain as it has not been approved in the EU. While a developer may be required to submit a method in the application for approval of a GM event to the regulatory authority, this method is considered confidential business information and is not made available in the public domain.
Dear Prof,
Currently we do not have any experience with the detection and identification of newly developed LMOs. I would allude this to the fact that there is no local entity that is involved in the development of LMOs in Malawi. Most of the LMOs will come from outside the country and by the time these products are granted entry into the country (which may take long due to the regulatory processes involved), a lot of technical information will have been known including detection methods. Nevertheless, there is fear when it comes to unauthorized LMOs that may come into the country illegally or unintetionally and for which we do not have the detection and identification tools. This may pose a serious threat to the environment and trade considering that some of our trade partners prefer non-GMO products. Furthermore, in the absence of the experience to detect and identify "new" LMO products, it may be difficult to establish the status quo with reference to prevalence of LMOs in the country, hence difficult to effect 'the polluter pays" principle.
Currently we do not have any experience with the detection and identification of newly developed LMOs. I would allude this to the fact that there is no local entity that is involved in the development of LMOs in Malawi. Most of the LMOs will come from outside the country and by the time these products are granted entry into the country (which may take long due to the regulatory processes involved), a lot of technical information will have been known including detection methods. Nevertheless, there is fear when it comes to unauthorized LMOs that may come into the country illegally or unintetionally and for which we do not have the detection and identification tools. This may pose a serious threat to the environment and trade considering that some of our trade partners prefer non-GMO products. Furthermore, in the absence of the experience to detect and identify "new" LMO products, it may be difficult to establish the status quo with reference to prevalence of LMOs in the country, hence difficult to effect 'the polluter pays" principle.
Dear Chris,
Nice hearing from you again.
I can assure you that you can find some information in our GMO database http://www.euginius.eu.
Regarding DP56113 (SPTA maintainer, MS44 maintainer): This event is probably not on its own since it is the restoration of fertility. Unfortunately, only P-35S could be detected here. No event-specific detection method yet.
HB4 wheat: more detectable elements, but no event-specific detection method yet.
HB4 soybean: P-35S, T-nos, bar and the construct-specific P-35S/bar could help. No event-specific detection method yet.
As far as I can see, the EURL-GMMFF also has not yet planned to validate methods for these events (https://gmo-crl.jrc.ec.europa.eu/method-validations)
Cheers,
Theo
Nice hearing from you again.
I can assure you that you can find some information in our GMO database http://www.euginius.eu.
Regarding DP56113 (SPTA maintainer, MS44 maintainer): This event is probably not on its own since it is the restoration of fertility. Unfortunately, only P-35S could be detected here. No event-specific detection method yet.
HB4 wheat: more detectable elements, but no event-specific detection method yet.
HB4 soybean: P-35S, T-nos, bar and the construct-specific P-35S/bar could help. No event-specific detection method yet.
As far as I can see, the EURL-GMMFF also has not yet planned to validate methods for these events (https://gmo-crl.jrc.ec.europa.eu/method-validations)
Cheers,
Theo
Hi everyone, greetings from Brazil. Our laboratory is one of the official units within the Official Laboratories Network under the Ministry of Agriculture and Livestock of Brazil, and it is the unit dedicated to the analysis of plant-based products. In Brazil, we have a significant number of authorized LMOs that we must monitor. For this reason, we are constantly implementing methodologies for the detection and identification of new targets.
The approval of new LMOs is a process carried out by our National Biosafety Technical Commission (CTNBio). After approval, applicants are required to provide the methodology and reference samples that we can use for domestic commerce control. However, this information is considered confidential and cannot be shared with other countries.
Regarding unauthorized LMOs, we work with a screening approach and, depending on the result, we verify whether the screening profile matches any authorized LMOs. Brazil is mainly an exporting country, but we still import certain products from specific countries. Because of this, we try to validate methodologies in our laboratory that cover LMOs authorized in the countries we import from, so that we can apply event-specific methods whenever possible. As mentioned by other participants, some methodologies are not available in the public domain, which makes this challenging. As for stacked events, we are able to identify individual events using event-specific methodologies, since we can extract DNA from a single individual sample, such as one leaf or one seed.
I believe this situation may become even more challenging in the future if methodologies continue to be classified as confidential, especially given the growing number of products obtained through New Breeding Techniques. Another key issue is the harmonization of legislation and regulatory procedures across countries.
The approval of new LMOs is a process carried out by our National Biosafety Technical Commission (CTNBio). After approval, applicants are required to provide the methodology and reference samples that we can use for domestic commerce control. However, this information is considered confidential and cannot be shared with other countries.
Regarding unauthorized LMOs, we work with a screening approach and, depending on the result, we verify whether the screening profile matches any authorized LMOs. Brazil is mainly an exporting country, but we still import certain products from specific countries. Because of this, we try to validate methodologies in our laboratory that cover LMOs authorized in the countries we import from, so that we can apply event-specific methods whenever possible. As mentioned by other participants, some methodologies are not available in the public domain, which makes this challenging. As for stacked events, we are able to identify individual events using event-specific methodologies, since we can extract DNA from a single individual sample, such as one leaf or one seed.
I believe this situation may become even more challenging in the future if methodologies continue to be classified as confidential, especially given the growing number of products obtained through New Breeding Techniques. Another key issue is the harmonization of legislation and regulatory procedures across countries.
Thank you very much, Mr. Amare Genetu, for sharing your experience from Ethiopia. Your contribution highlights key points for our discussion:
• Your laboratory applies established PCR methods for GMO detection in maize and soybean using specific targets and internal controls.
• No unauthorized GMOs have been found so far, likely reflecting Ethiopia’s predominantly organic crop production.
• Collaboration with universities and research institutions helps address technical limitations and equipment gaps.
• Access to positive GMO control samples remains a major challenge, with only MON810 maize and Bt-cotton currently available.
Thank you again for your valuable input.
• Your laboratory applies established PCR methods for GMO detection in maize and soybean using specific targets and internal controls.
• No unauthorized GMOs have been found so far, likely reflecting Ethiopia’s predominantly organic crop production.
• Collaboration with universities and research institutions helps address technical limitations and equipment gaps.
• Access to positive GMO control samples remains a major challenge, with only MON810 maize and Bt-cotton currently available.
Thank you again for your valuable input.
Responses to Topic 2: Experience with detecting and identifying newly developed LMOs, unauthorized LMOs, and stacked events
Hi David,
I am please to submit these responses on behalf of the CSIR–CRI Team, Ghana.
a) Could you describe your experience with the detection and identification of newly developed LMOs?
Our laboratory currently screens only for the CaMV 35S promoter and NOS terminator, and as such, we do not yet have the capacity to detect newly developed LMOs such as those produced through new genomic techniques or constructs that lack these targets.
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
Similarly, we do not have experience detecting unauthorized LMOs. Our current assays cannot identify specific events or unknown modifications, so we are unable to distinguish between authorized and unauthorized LMOs beyond general screening for 35S or NOS.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
Not applicable, as we have not yet implemented screening strategies or analytical tools that would enable detection of new or unauthorized LMOs.
d) What challenges do you foresee in the near future for these types of LMOs?
Our lack of capacity and tools to detect newly developed or unauthorized LMOs leaves our testing restricted to general screening targets, which poses risks to trade exports, especially to clients whose export markets prefer non-GMO products. This also heightens the risk of undetected entry of unauthorized LMOs into the country. Furthermore, without expertise to identify new LMOs, establishing a national baseline for LMO prevalence in Ghana is challenging. Urgent investment in training, equipment, and resources is needed to adopt more comprehensive detection strategies and address these gaps.
Hi David,
I am please to submit these responses on behalf of the CSIR–CRI Team, Ghana.
a) Could you describe your experience with the detection and identification of newly developed LMOs?
Our laboratory currently screens only for the CaMV 35S promoter and NOS terminator, and as such, we do not yet have the capacity to detect newly developed LMOs such as those produced through new genomic techniques or constructs that lack these targets.
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
Similarly, we do not have experience detecting unauthorized LMOs. Our current assays cannot identify specific events or unknown modifications, so we are unable to distinguish between authorized and unauthorized LMOs beyond general screening for 35S or NOS.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
Not applicable, as we have not yet implemented screening strategies or analytical tools that would enable detection of new or unauthorized LMOs.
d) What challenges do you foresee in the near future for these types of LMOs?
Our lack of capacity and tools to detect newly developed or unauthorized LMOs leaves our testing restricted to general screening targets, which poses risks to trade exports, especially to clients whose export markets prefer non-GMO products. This also heightens the risk of undetected entry of unauthorized LMOs into the country. Furthermore, without expertise to identify new LMOs, establishing a national baseline for LMO prevalence in Ghana is challenging. Urgent investment in training, equipment, and resources is needed to adopt more comprehensive detection strategies and address these gaps.
Dear Theo,
Good to hear from you.
It is important to note that within our regulatory environment, there is no requirement for developers to make positive control material available to GM detection laboratories. In addition, while developers do provide a detection method as part of the approval process, the latter is considered confidential business information and is not shared with GM detection laboratories.
While our laboratory performs the element screening as you suggested, we cannot conclusively identify the GM events referred to in my post despite the fact that these events have been approved in South Africa.
Kind regards
Chris
Good to hear from you.
It is important to note that within our regulatory environment, there is no requirement for developers to make positive control material available to GM detection laboratories. In addition, while developers do provide a detection method as part of the approval process, the latter is considered confidential business information and is not shared with GM detection laboratories.
While our laboratory performs the element screening as you suggested, we cannot conclusively identify the GM events referred to in my post despite the fact that these events have been approved in South Africa.
Kind regards
Chris
Dear Professor Dobnik,
Thank you for moderating this critical topic, which sits at the frontier of GMO/LMO detection and enforcement. My name is Danial Kahrizi, and my work in Iran focuses on oilseed crop biotechnology, with a dedicated interest in advancing our national capabilities for LMO identification. Our context is shaped by a unique set of challenges, including economic sanctions that restrict access to cutting-edge equipment and international genomic databases, making the detection of novel LMOs particularly demanding.
Please find below my responses to your guiding questions.
a) Experience with the detection and identification of newly developed LMOs:
Our direct experience with newly developed LMOs, particularly those derived from New Genomic Techniques (NGTs), is limited. Iran's regulatory framework for NGT products is still under development, and such products have not yet entered the market in a significant way. Consequently, our practical detection efforts have primarily focused on established, "classical" transgenic events. However, we actively monitor the scientific literature (as evidenced in Topic 1) to understand the molecular signatures of NGT products, such as specific indels in genes like FAD2 in soybean or AHAS in canola. We are proactively developing in-house bioinformatics pipelines to analyze hypothetical NGS data for such edits, preparing for their potential future appearance.
b) Experience regarding the detection and identification of unauthorized LMOs:
The primary challenge with unauthorized LMOs in Iran is their potential entry through informal trade channels. Our strategy relies on a multi-tiered screening approach:
Element-Specific Screening: We use qPCR to screen for common genetic elements (e.g., P-35S, T-NOS, pat, bar). A positive signal for a combination of elements not corresponding to any authorized event triggers a red flag.
Gene-Specific and Construct-Specific Testing: If resources allow, we proceed to identify the specific genes and potentially the construct.
However, the definitive identification of an entirely unknown, unauthorized event is severely hampered by our limited access to comprehensive, up-to-date international GMO sequence databases and the high cost of NGS. Without a reference sequence, confirmation remains a significant challenge.
c) Steps taken or analytical tools implemented to overcome challenges:
To navigate these constraints, we have adopted a strategy of "intellectual agility and targeted method development."
In-House Bioinformatics Capacity: We have invested in building local bioinformatics expertise to analyze sequencing data. This is a crucial force-multiplier, allowing us to extract maximum information from limited data.
Focus on Open-Source Tools and Data: We prioritize the use of open-source bioinformatics tools and publicly available genomic data for method development and training.
Collaborative Proficiency: We leverage international academic collaborations. By sending researchers abroad, we gain access to NGS platforms and advanced analytical capabilities, which we then use to analyze difficult samples or validate our in-house findings indirectly.
Enhanced Stacked Event Detection: For stacked events, we have developed and validated multiplex qPCR assays capable of detecting multiple transgenes in a single reaction. This is a cost-effective way to screen for common stacks without resorting to more expensive whole-genome approaches.
d) Challenges foreseen in the near future for these types of LMOs:
The near future presents several formidable challenges:
The NGT Tsunami: The increasing commercialization of NGT-derived products, which may lack foreign DNA and contain only minimal edits, will render our current element-based screening strategies obsolete. This will necessitate a fundamental shift towards sequence-based detection and characterization.
The Bioinformatics Bottleneck: As NGS becomes indispensable, the lack of standardized, user-friendly, and affordable bioinformatics pipelines will be the single greatest bottleneck for laboratories like ours.
The Digital Divide: Restricted access to curated genomic databases and proprietary bioinformatics software will exacerbate the gap between well-resourced and constrained laboratories, undermining global biosafety traceability.
Complex Stacked and Pyramided Events: The proliferation of increasingly complex stacked events will challenge the multiplexing capacity of qPCR and require a greater reliance on dPCR and NGS for definitive characterization.
In conclusion, our experience in Iran highlights that the future of LMO detection is not solely a technological race but a battle against information and resource asymmetry. Building global capacity, therefore, must include democratizing access to bioinformatics tools, data, and affordable sequencing services.
Sincerely,
Danial Kahrizi
Thank you for moderating this critical topic, which sits at the frontier of GMO/LMO detection and enforcement. My name is Danial Kahrizi, and my work in Iran focuses on oilseed crop biotechnology, with a dedicated interest in advancing our national capabilities for LMO identification. Our context is shaped by a unique set of challenges, including economic sanctions that restrict access to cutting-edge equipment and international genomic databases, making the detection of novel LMOs particularly demanding.
Please find below my responses to your guiding questions.
a) Experience with the detection and identification of newly developed LMOs:
Our direct experience with newly developed LMOs, particularly those derived from New Genomic Techniques (NGTs), is limited. Iran's regulatory framework for NGT products is still under development, and such products have not yet entered the market in a significant way. Consequently, our practical detection efforts have primarily focused on established, "classical" transgenic events. However, we actively monitor the scientific literature (as evidenced in Topic 1) to understand the molecular signatures of NGT products, such as specific indels in genes like FAD2 in soybean or AHAS in canola. We are proactively developing in-house bioinformatics pipelines to analyze hypothetical NGS data for such edits, preparing for their potential future appearance.
b) Experience regarding the detection and identification of unauthorized LMOs:
The primary challenge with unauthorized LMOs in Iran is their potential entry through informal trade channels. Our strategy relies on a multi-tiered screening approach:
Element-Specific Screening: We use qPCR to screen for common genetic elements (e.g., P-35S, T-NOS, pat, bar). A positive signal for a combination of elements not corresponding to any authorized event triggers a red flag.
Gene-Specific and Construct-Specific Testing: If resources allow, we proceed to identify the specific genes and potentially the construct.
However, the definitive identification of an entirely unknown, unauthorized event is severely hampered by our limited access to comprehensive, up-to-date international GMO sequence databases and the high cost of NGS. Without a reference sequence, confirmation remains a significant challenge.
c) Steps taken or analytical tools implemented to overcome challenges:
To navigate these constraints, we have adopted a strategy of "intellectual agility and targeted method development."
In-House Bioinformatics Capacity: We have invested in building local bioinformatics expertise to analyze sequencing data. This is a crucial force-multiplier, allowing us to extract maximum information from limited data.
Focus on Open-Source Tools and Data: We prioritize the use of open-source bioinformatics tools and publicly available genomic data for method development and training.
Collaborative Proficiency: We leverage international academic collaborations. By sending researchers abroad, we gain access to NGS platforms and advanced analytical capabilities, which we then use to analyze difficult samples or validate our in-house findings indirectly.
Enhanced Stacked Event Detection: For stacked events, we have developed and validated multiplex qPCR assays capable of detecting multiple transgenes in a single reaction. This is a cost-effective way to screen for common stacks without resorting to more expensive whole-genome approaches.
d) Challenges foreseen in the near future for these types of LMOs:
The near future presents several formidable challenges:
The NGT Tsunami: The increasing commercialization of NGT-derived products, which may lack foreign DNA and contain only minimal edits, will render our current element-based screening strategies obsolete. This will necessitate a fundamental shift towards sequence-based detection and characterization.
The Bioinformatics Bottleneck: As NGS becomes indispensable, the lack of standardized, user-friendly, and affordable bioinformatics pipelines will be the single greatest bottleneck for laboratories like ours.
The Digital Divide: Restricted access to curated genomic databases and proprietary bioinformatics software will exacerbate the gap between well-resourced and constrained laboratories, undermining global biosafety traceability.
Complex Stacked and Pyramided Events: The proliferation of increasingly complex stacked events will challenge the multiplexing capacity of qPCR and require a greater reliance on dPCR and NGS for definitive characterization.
In conclusion, our experience in Iran highlights that the future of LMO detection is not solely a technological race but a battle against information and resource asymmetry. Building global capacity, therefore, must include democratizing access to bioinformatics tools, data, and affordable sequencing services.
Sincerely,
Danial Kahrizi
Dear Chris,
Thanks for your additional information. It indeed must be difficult to work under these conditions.
Sorry I cannot be of any help. Please contact me if I can be of any assistance in the future.
Cheers,
Theo
Thanks for your additional information. It indeed must be difficult to work under these conditions.
Sorry I cannot be of any help. Please contact me if I can be of any assistance in the future.
Cheers,
Theo
Dear Chris,
Please have a look at the patent: https://www.lens.org/lens/patent/138-533-542-723-921/fulltext
This looks like an event-specific detection method for maize DP56113.
DP56113-9 forward primer GAAGGAAACGAGTGAAGCGGT (SEQ ID NO: 15) 21 bp
DP56113-9 reverse primer GCGTCAATTTGTTTACACCACAA (SEQ ID NO: 16) 23 bp
DP56113-9 probe CAACTTAATAACGATATACACGATAT (SEQ ID NO: 17) 26 bp.
You could consider ordering a synthetic target so you can validate the method.
I do not oversee the legal issues if you want to apply this method for routine analysis.
Cheers,
Theo
Please have a look at the patent: https://www.lens.org/lens/patent/138-533-542-723-921/fulltext
This looks like an event-specific detection method for maize DP56113.
DP56113-9 forward primer GAAGGAAACGAGTGAAGCGGT (SEQ ID NO: 15) 21 bp
DP56113-9 reverse primer GCGTCAATTTGTTTACACCACAA (SEQ ID NO: 16) 23 bp
DP56113-9 probe CAACTTAATAACGATATACACGATAT (SEQ ID NO: 17) 26 bp.
You could consider ordering a synthetic target so you can validate the method.
I do not oversee the legal issues if you want to apply this method for routine analysis.
Cheers,
Theo
Dear Prof. Dobnik, thank you again for the opportunity to share on the topic concerning experience with detecting and identifying newly developed LMOs, unauthorized LMOs, and stacked events
regarding the first question a) on experiences with detection and identification of newly developed LMOs, unfortunately, our laboratory currently only does qualitative
screening focusing merely on the presence or absence of promoters and terminators thereby limiting the capability to detect or quantify specific events that could be conferred to using advanced genetic modification techniques, or those that do not use the pool of promoter/ terminator that we use.
b) On the issue of the Experience with detecting and identifying newly developed LMOs, unauthorized LMOs and stacked events. As earlier mentioned, the limitation raised on a), coupled with inadequate modern equipment and technologies, incapacitates our laboratory to have much experience with the detection and identification of unauthorised LMOs.
c) Also, on the issue of what steps have been taken or analytical tools implemented to overcome the challenges faced, the first one has been appreciating the incapability technology-wise that there is need to upgrade on technology used in our detection efforts as well as human capacity building.
lastly, concerning d) challenges foreseen in the near future on these types of LMOs, the obvious challenge would be the inability to correctly identify these LMOs thereby incapacitating LMOs country efflux and influx control efforts as well as research or prevalence statistics over the same.
regarding the first question a) on experiences with detection and identification of newly developed LMOs, unfortunately, our laboratory currently only does qualitative
screening focusing merely on the presence or absence of promoters and terminators thereby limiting the capability to detect or quantify specific events that could be conferred to using advanced genetic modification techniques, or those that do not use the pool of promoter/ terminator that we use.
b) On the issue of the Experience with detecting and identifying newly developed LMOs, unauthorized LMOs and stacked events. As earlier mentioned, the limitation raised on a), coupled with inadequate modern equipment and technologies, incapacitates our laboratory to have much experience with the detection and identification of unauthorised LMOs.
c) Also, on the issue of what steps have been taken or analytical tools implemented to overcome the challenges faced, the first one has been appreciating the incapability technology-wise that there is need to upgrade on technology used in our detection efforts as well as human capacity building.
lastly, concerning d) challenges foreseen in the near future on these types of LMOs, the obvious challenge would be the inability to correctly identify these LMOs thereby incapacitating LMOs country efflux and influx control efforts as well as research or prevalence statistics over the same.
Dear Prof David Dobnik,
We are Dr Hamidou MAIGA and Mr Inoussa TOE. We work together to answer questions on this platform as representatives of the team at the instititut de recherche en sciences - Direction Régionale de l'ouest de la santé (IRSS-DRO) of Burkina Faso.
a) Could you describe your experience with the detection and identification of newly developed LMOs? & b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
As a young specialist team, we are currently building up our operational experience in LMOs detection and identification. Our fundamental expertise is currently based on research into gene drive systems, which has enabled us to develop solid skills in advanced molecular biology and a detailed understanding of the regulatory issues associated with new genomic techniques in collaboration with the Liverpool School of Tropical Médecine.
We share international concerns about the threat posed by unauthorised or illegally released GMOs. Without pre-established target detection methods, these products pose a significant risk to biodiversity and biological security.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
To overcome these difficulties, we have taken a proactive approach to strengthening our capabilities in cutting-edge technologies, particularly bioinformatics for sequencing data analysis (NGS) and digital PCR (ddPCR), which is recognised for its sensitivity in detecting rare events and analysing eDNA.
We want to prioritise the development of non-targeted detection methods, such as NGS sequencing, capable of identifying unknown genetic modifications, to complement targeted methods such as PCR.
d) What challenges do you foresee in the near future for these types of LMOs?
1. The technology gap: Keeping pace with the extremely rapid evolution of genome editing techniques, which will require sustained and continuous financial investment in equipment and training.
2. Detecting the unknown: The major difficulty will remain the development of robust strategies to identify and trace LMOs for which no genetic information is publicly available, which is crucial.
We are Dr Hamidou MAIGA and Mr Inoussa TOE. We work together to answer questions on this platform as representatives of the team at the instititut de recherche en sciences - Direction Régionale de l'ouest de la santé (IRSS-DRO) of Burkina Faso.
a) Could you describe your experience with the detection and identification of newly developed LMOs? & b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
As a young specialist team, we are currently building up our operational experience in LMOs detection and identification. Our fundamental expertise is currently based on research into gene drive systems, which has enabled us to develop solid skills in advanced molecular biology and a detailed understanding of the regulatory issues associated with new genomic techniques in collaboration with the Liverpool School of Tropical Médecine.
We share international concerns about the threat posed by unauthorised or illegally released GMOs. Without pre-established target detection methods, these products pose a significant risk to biodiversity and biological security.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
To overcome these difficulties, we have taken a proactive approach to strengthening our capabilities in cutting-edge technologies, particularly bioinformatics for sequencing data analysis (NGS) and digital PCR (ddPCR), which is recognised for its sensitivity in detecting rare events and analysing eDNA.
We want to prioritise the development of non-targeted detection methods, such as NGS sequencing, capable of identifying unknown genetic modifications, to complement targeted methods such as PCR.
d) What challenges do you foresee in the near future for these types of LMOs?
1. The technology gap: Keeping pace with the extremely rapid evolution of genome editing techniques, which will require sustained and continuous financial investment in equipment and training.
2. Detecting the unknown: The major difficulty will remain the development of robust strategies to identify and trace LMOs for which no genetic information is publicly available, which is crucial.
Thank you, David Dobnik, for moderating this discussion.
I am Precious Adeyemi, an analyst in the GMO Detection and Analysis Laboratory of the National Biosafety Management Agency, Nigeria.
So far, we have not had any experience in detecting or identifying newly developed LMOs, unauthorized LMOs and stacked events. We are still finding our footing in accurately detecting the few single events that we have commercialized or approved for CFT in our country. Stacked events that have been approved were analysed by detecting the single events separately. As for newly developed and unauthorized LMOs, we are yet to begin detecting those due to gaps in funding, capacity, and infrastructure. We also carry out detection to enforce compliance to our labelling regulations.
We are hopeful that in the near future, these gaps will be closed and we will be well equipped to move beyond our current state to accurately detecting and analysing these categories of LMOs.
I am Precious Adeyemi, an analyst in the GMO Detection and Analysis Laboratory of the National Biosafety Management Agency, Nigeria.
So far, we have not had any experience in detecting or identifying newly developed LMOs, unauthorized LMOs and stacked events. We are still finding our footing in accurately detecting the few single events that we have commercialized or approved for CFT in our country. Stacked events that have been approved were analysed by detecting the single events separately. As for newly developed and unauthorized LMOs, we are yet to begin detecting those due to gaps in funding, capacity, and infrastructure. We also carry out detection to enforce compliance to our labelling regulations.
We are hopeful that in the near future, these gaps will be closed and we will be well equipped to move beyond our current state to accurately detecting and analysing these categories of LMOs.
Dear colleagues,
My name is Daniela Wahler. I work for the German Federal Office of Consumer Protection and Food Safety (BVL). BVL is home to a working group that has the legal mandate to publish an official collection of methods of sampling and analysis of LMO in Germany (§ 28 b GenTG Working Group) and the national reference laboratory for genetically modified organisms (NRL-GMO).
I would like to thank the Secretariat for the opportunity to, again, share experiences on the detection and identification of newly developed LMOs, unauthorized LMOs and stacked events and David for resuming on the discussions we had in this forum in 2023. Within the last two years there has been no breakthrough in the detection and identification of newly developed or unauthorized LMO or stacked events. To briefly recall from 2023 on approaches chosen in Germany:
A prerequisite for authorisation of a LMO in the European Union for food, feed and processing is the access to reference material and a method that allows identification;
stacked events are detected by means of the respective single-event methods;
German control laboratories constantly adapt their portfolio of standard screening-, construct- and event-specific methods to allow detection of unauthorized LMOs. However, this relies on the availability of information on the genetic modification and the access to suitable reference material.
As before but also within the last two years, the above mentioned § 28b Working Group is developing detection methods for unauthorized LMOs. The decision on which LMOs exactly methods will be developed depends on their market-relevance and access to information on their molecular modification. It needs to be emphasised that the focus is on mere detection but not quantification as there is a zero tolerance for unauthorised LMOs within the European Union.
As genome-edited organisms currently fall under the EU LMO legislation, among those methods are also some that detect such kind of newly developed LMOs. To give you examples of efforts where members of the § 28 b Working Group participated, please refer to some recent publications doi: 10.1007/s00003-024-01538-0, https://link.springer.com/article/10.1007/s00003-024-01538-0: Development and in-house validation of two real-time PCR methods for the detection of genome-editing events in soybean FAD2 gene variants;
doi: 10.1016/j.foodcont.2023.109869, https://www.sciencedirect.com/science/article/pii/S0956713523002694: Detection of commercialized plant products derived from new genomic techniques (NGT) - Practical examples and current perspectives;
doi:10.1007/s00003-025-01542-y, https://link.springer.com/article/10.1007/s00003-025-01542-y: Current status and trends in the analysis of GMO and new genomic techniques).
In summary, in cases where information and access to reference material was available, easy to incorparate and cost-effective qPCR approaches for detection could be developed. However, the identification of genome-edited is much more challenging; especially regarding genome-edited products with small modifications.
As mentioned by my colleague Theo Pris (#12846), we provide data on detection methods and LMO analytical strategies in our freely accessible EUginius database: http://www.euginius.eu. Please also refer to the German table of screening methods which is continuously extended https://euginius.eu/euginius/pages/methodSearch_searchview.jsf (select method set ABC).
Kind regards,
Daniela
My name is Daniela Wahler. I work for the German Federal Office of Consumer Protection and Food Safety (BVL). BVL is home to a working group that has the legal mandate to publish an official collection of methods of sampling and analysis of LMO in Germany (§ 28 b GenTG Working Group) and the national reference laboratory for genetically modified organisms (NRL-GMO).
I would like to thank the Secretariat for the opportunity to, again, share experiences on the detection and identification of newly developed LMOs, unauthorized LMOs and stacked events and David for resuming on the discussions we had in this forum in 2023. Within the last two years there has been no breakthrough in the detection and identification of newly developed or unauthorized LMO or stacked events. To briefly recall from 2023 on approaches chosen in Germany:
A prerequisite for authorisation of a LMO in the European Union for food, feed and processing is the access to reference material and a method that allows identification;
stacked events are detected by means of the respective single-event methods;
German control laboratories constantly adapt their portfolio of standard screening-, construct- and event-specific methods to allow detection of unauthorized LMOs. However, this relies on the availability of information on the genetic modification and the access to suitable reference material.
As before but also within the last two years, the above mentioned § 28b Working Group is developing detection methods for unauthorized LMOs. The decision on which LMOs exactly methods will be developed depends on their market-relevance and access to information on their molecular modification. It needs to be emphasised that the focus is on mere detection but not quantification as there is a zero tolerance for unauthorised LMOs within the European Union.
As genome-edited organisms currently fall under the EU LMO legislation, among those methods are also some that detect such kind of newly developed LMOs. To give you examples of efforts where members of the § 28 b Working Group participated, please refer to some recent publications doi: 10.1007/s00003-024-01538-0, https://link.springer.com/article/10.1007/s00003-024-01538-0: Development and in-house validation of two real-time PCR methods for the detection of genome-editing events in soybean FAD2 gene variants;
doi: 10.1016/j.foodcont.2023.109869, https://www.sciencedirect.com/science/article/pii/S0956713523002694: Detection of commercialized plant products derived from new genomic techniques (NGT) - Practical examples and current perspectives;
doi:10.1007/s00003-025-01542-y, https://link.springer.com/article/10.1007/s00003-025-01542-y: Current status and trends in the analysis of GMO and new genomic techniques).
In summary, in cases where information and access to reference material was available, easy to incorparate and cost-effective qPCR approaches for detection could be developed. However, the identification of genome-edited is much more challenging; especially regarding genome-edited products with small modifications.
As mentioned by my colleague Theo Pris (#12846), we provide data on detection methods and LMO analytical strategies in our freely accessible EUginius database: http://www.euginius.eu. Please also refer to the German table of screening methods which is continuously extended https://euginius.eu/euginius/pages/methodSearch_searchview.jsf (select method set ABC).
Kind regards,
Daniela
Dear David,
Sorry for the late reply.
My name is Minosoa, and I work at the Plant Molecular Biology Laboratory, University of Antananarivo, Madagascar.
a) Could you describe your experience with the detection and identification of newly developed LMOs?
Since the laboratory has not yet been officially mandated, no analyses of new generations of GMOs have been carried out to date. The only exception occurred in 2021, when CIRAD submitted a request to introduce a genetically edited, salt-tolerant rice cultivar in Madagascar. The DNA extraction was performed in Madagascar, and the resulting extracts were sent to South Africa for analysis, where the modified genomic region was successfully identified.
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
Currently, the laboratory only has one RT-PCR device for detection, and we do not have the additional equipment or financial resources necessary to perform this type of analysis.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
As I mentioned in the first section, for the requests we received at the laboratory in 2021, we extracted DNA in Madagascar and then sent the extracted DNA to South Africa, which was very costly and time-consuming.
d) What challenges do you foresee in the near future for these types of LMOs?
The main challenges for the laboratory are funding and equipment procurement, which are the main factors limiting the development of effective detection of newly developed GMOs.
Sincerely,
Minosoa
Sorry for the late reply.
My name is Minosoa, and I work at the Plant Molecular Biology Laboratory, University of Antananarivo, Madagascar.
a) Could you describe your experience with the detection and identification of newly developed LMOs?
Since the laboratory has not yet been officially mandated, no analyses of new generations of GMOs have been carried out to date. The only exception occurred in 2021, when CIRAD submitted a request to introduce a genetically edited, salt-tolerant rice cultivar in Madagascar. The DNA extraction was performed in Madagascar, and the resulting extracts were sent to South Africa for analysis, where the modified genomic region was successfully identified.
b) Similarly, what experience can you share regarding the detection and identification of unauthorized LMOs?
Currently, the laboratory only has one RT-PCR device for detection, and we do not have the additional equipment or financial resources necessary to perform this type of analysis.
c) To overcome the challenges faced, what steps did you take, or analytical tools did you implement?
As I mentioned in the first section, for the requests we received at the laboratory in 2021, we extracted DNA in Madagascar and then sent the extracted DNA to South Africa, which was very costly and time-consuming.
d) What challenges do you foresee in the near future for these types of LMOs?
The main challenges for the laboratory are funding and equipment procurement, which are the main factors limiting the development of effective detection of newly developed GMOs.
Sincerely,
Minosoa
Because information on new developments and unauthorized events is not always readily available, their detection is nearly impossible. In the cases we have encountered, having positive material is critical to ensure that the implemented methodology is correct and the result reliable.
In this regard, collaboration between laboratories is of great importance, as it can facilitate access to these materials and promptly address any analytical needs that may arise.
Currently, at CNRIBA, we perform individual analyses for each event. Stacks can be identified, but only through a single reaction for each event.
In this regard, collaboration between laboratories is of great importance, as it can facilitate access to these materials and promptly address any analytical needs that may arise.
Currently, at CNRIBA, we perform individual analyses for each event. Stacks can be identified, but only through a single reaction for each event.
Dear Participants,
Thank you very much for your invaluable contributions and active participation in the Online discussions of the Network of Laboratories for the Detection and Identification of Living Modified Organisms. Your thoughtful insights and shared experiences have greatly enriched the exchange.
The Secretariat will carefully review and analyse the information provided and will prepare a comprehensive synthesis to inform and support future work of the network.
The online forum is now closed for comments.
Kind regards,
The Secretariat
Thank you very much for your invaluable contributions and active participation in the Online discussions of the Network of Laboratories for the Detection and Identification of Living Modified Organisms. Your thoughtful insights and shared experiences have greatly enriched the exchange.
The Secretariat will carefully review and analyse the information provided and will prepare a comprehensive synthesis to inform and support future work of the network.
The online forum is now closed for comments.
Kind regards,
The Secretariat